Nucleotide Record
Accession: L37330 
GI: 565251 
Strain: A/Leningrad/134/17/1957(H2N2) 
Definition: Influenza A virus (A/Leningrad/134/17/1957(H2N2)) neuraminidase (NA) gene, complete cds. 
Country: Russia 
District: Leningrad 
Host: Human 
Organism: Human 
Segment: NA 
Type: A 
Subtype: H2N2 
Year: 1957 
Length: 1467 
Full-length: Yes 
Q-Filter Category: C4 
CDS length:1410
CDS range:20-1429
Sequence:AGCAAAAGCAGGAGTGAAGATGAATCCAAATCAAAAGATAATAACAATTGGCTCTGTCTCTCTCACCATTGCAACAGCATGCTCCCTCAT
GCAGATTGCCATCCTGGCAACTACTGTGACATTGCATTTTAAGCAACATGAGTGCGACTCCCCCGCGAGCAACCAAGTAATGCCATGTGA
ACCAATAATAATAGAAAGGAACATAACAGAGATAGTGTATTTGAATAACACCACCATAGAGAAAGAGATTTGCCCCGAAGTAGTGGAATA
CAGAAATTGGTCAAAGCCGCAATGTCAAATTACAGGATTTGCACCTTTTTCTAAGGACAATTCAATCCGGCTTTCTGCTGGTGGGGACAT
TTGGGTGACGAGAGAACCTTATGTGTCATGCGATCCTGGCAAGTGTTATCAATTTGCACTCGGGCAGGGGACCACACTAGACAACAAACA
TTCAAATGGCACAATACATGATAGAATCCCTCATCGAACCCTATTAATGAATGAGTTGGGTGTTCCATTTCATTTAGGAACCAAACAAGT
GTGTGTAGCATGGTCCAGCTCAAGTTGTCACGATGGAAAAGCATGGTTGCATGTTTGTGTCACTGGGGATGATAGAAATGCAACTGCTAG
CTTCATTTATGACGGGAGGCTTGTGGACAGTATTGGTTCATGGTCTCAAAATATCCTCAGGACCCAGGAGTCGGAATGCGTTTGTATCAA
TGGGACTTGCACAGTAGTAATGACTGATGGAAGTGCATCAGGAAGAGCCGATACTAGAATACTATTCATTAAAGAGGGGAAAATTGTCCA
TATTAGCCCATTGTCAGGAAGTGCTCAGCATATAGAGGAGTGTTCCTGTTACCCTCGATATCCTGACGTCAGATGTATCTGCAGAGACAA
CTGGAAAGGCTCTAATAGGCCCGTTATAGACATAAATATGGAAGATTATAGCATTGATTCCAGTTATGTGTGCTCAGGGCTTGTTGGCGA
CACACCCAGGAACGACGACAGCTCTAGCAATAGCAATTGCAGGGATCCTAACAATGAGAGAGGGAATCCAGGAGTGAAAGGCTGGGCCTT
TGACAATGGAGATGATGTATGGATGGGAAGAACAATCAGCAAAGATTCACGCTCAGGTTATGAAACTTTCAAAGTCATTGGTGGTTGGTC
CACACCTAATTCCAAATCGCAGGTCAATAGACAGGTCATAGTTGACAACAATAATTGGTCTGGTTACTCTGGTATTTTCTCTGTTGAGGG
CAAAAGCTGCATCAATAGGTGCTTTTATGTGGAGTTGATAAGGGGAAGGCCACAGGAGACTAGAGTATGGTGGACCTCAAACAGTATTGT
TGTGTTTTGTGGCACTTCAGGTACTTATGGAACAGGCTCATGGCCTGATGGGGCGAACATCAATTTCATGCCTATATAA
GCTTTCGCAAT
TTTAGAAAAAAACTCCTTGTTTCTACT
GenBank link View GenBank Entry (at NCBI)

Protein Record
Accession:AAA96710
GI:565252
Definition:neuraminidase [Influenza A virus (A/Leningrad/134/17/1957(H2N2))]
Length:469
Sequence:
GenBank link View GeneBank Entry (at NCBI)