Nucleotide Record
Accession: L33481 
GI: 495800 
Strain: A/Leningrad/133/1991(H1N1) 
Definition: Influenza A virus (A/Leningrad/133/1991(H1N1)) haemagglutinin gene, partial cds. 
Country: Russia 
District: Leningrad 
Host: Human 
Organism: Human 
Segment: HA 
Type: A 
Subtype: H1N1 
Year: 1991 
Length: 1032 
Full-length: No 
Q-Filter Category: P1 
CDS length:1032
CDS range:1->1032
Sequence:ATGAAAGCAAAACTACTAGTCCTGTTATGTGCATTTACAGCTACATATGCAGACACAATATGTATAGGCTACCATGCGAACAACTCAACC
GACACTGTTGACACAGTACTTGAGAAGAACGTGACAGTGACACACTCTGTCAACCTACTTGAGGACAGTCACAACGGGAAACTATGTCGA
CTAAAAGGAATAGCCCCACTACAATTGGGTAATTGCAGCGTTGCCGGATGGATCTTAGGAAACCCAGAATGCGAATCACTGTTTTCTAAG
GAATCATGGTCCTACATTGCAGAAACACCAAACCCTGAGAATGGAACATGTTACCCAGGGTATTTCGCCGACTATGAGGAACTGAGGGAG
CAATTGAGTTCAGTATCATCATTCGAGAGATTCGAAATATTCCCCAAAGGAAGCTCATGGCCCAACCACACCGTAACCAAAGGAGTAACG
GCATCATGCTCCCATAATGGGAAAAGCAGTTTTTACAGAAATTTGCTATGGCTGACGGAGAAGAATGGCTTGTACCCAAATCTGAGCAAG
TCCTATGTAAACAACAAAGAGAAAGAAGTCCTTGTACTGTGGGGTGTTCATCACCCGTCTAACATAAGGGACCAAAGGGCCATCTATCAT
ACAGAAAATGCTTATGTCTCTGTAGTGTCTTCACATTATAGCAGAAGATTCACCCCAGAAATAGCAAAAAGACCCAAAGTAAGAGRTCAA
GAAGGAAGAATCAACTACTACTGGACTCTGCTGGAACCCGGGGACACAATAATATTTGAGGCAAATGGAAATCTAATAGCGCCATGGTAT
GCTTTCGCACTGAGTAGAGGTTTTGGGTCAGGAATCATCACCTCAAACGCATCAATGAATGAATGTGACGCGAAGTGTCAAACACCCCAG
GGAGCTATAAACAGTAGTCTTCCTTTCCAGAATGTACACCCAGTCACAATAGGAGAGTGTCCAAAGTATGTCAGGAGTACAAAATTAAGG
ATGGTTACAGGACTAAGGAACATCCCATCCATTCAATCCAGA
GenBank link View GenBank Entry (at NCBI)

Protein Record
Accession:AAA65545
GI:495801
Definition:haemagglutinin [Influenza A virus (A/Leningrad/133/1991(H1N1))]
Length:344
Sequence:
GenBank link View GeneBank Entry (at NCBI)