Nucleotide Record
Accession: L11134 
GI: 408524 
Strain: A/Krasnodar/101/59 (H2N2) 
Definition: Influenza A virus (A/Krasnodar/101/59 (H2N2)) hemagglutinin (HA) gene, complete cds. 
Country: Russia 
District: Krasnodar 
Host: Human 
Organism: Human 
Segment: HA 
Type: A 
Subtype: H2N2 
Year: 1959 
Length: 1773 
Full-length: Yes 
Q-Filter Category: C4 
CDS length:1689
CDS range:44-1732
Sequence:AGCAAAAGCAGGGGTTATACCATAGACAACCAAAAGCAAAACAATGGCCATCATTTATCTCATTCTCCTGTTCACAGCAGTGAGAGGGGA
CCAGATATGCATTGGATACCATGCCAATAATTCCACAGAGAAGGTCGACACAATTCTAGAGCGGAACGTCACTGTGACTCATGCCAAGGA
CATTCTTGAGAAGACCCATAACGGAAAGTTATGCAAACTAAACGGAATCCCTCCACTTGAACTAGGGGACTGTAGCATTGCCGGATGGCT
CCTTGGAAATCCAGAATGTGATAGGCTTCTAAGTGTGCCAGAATGGTCCTATATAATGGAGAAAGAAAACCCGAGAGACGGTTTGTGTTA
TCCAGGCAGCTTCAATGATTATGAAGAATTGAAACATCTCCTCAGCAGCGTGAAACATTTCGAGAAAGTAAAGATTCTGCCCAAAGATAG
ATGGACACAGCATACAACAACTGGAGGTTCACGGGCCTGCGCGGTGTCTGGTAATCCATCATTCTTCAGGAACATGGTCTGGCTGACACA
GAAAGGATCAAATTATCCGGTTGCCAAAGGATCGTACAACAATACAAGCGGAGAACAAATGCTAATAATTTGGGGGGTGCACCATCCCAA
TGATGAGACAGAACAAAGAACATTGTACCAGAATGTGGGAACCTATGTTTCCGTAGGCACATCAACATTGAACAAAAGGTCAACCCCAGA
CATAGCAACAAGGCCTAAAGTGAATGGACAAGGAGGTAGAATGGAATTCTCTTGGACCCTATTGGATATGTGGGACACCATAAATTTTGA
GAGTACTGGTAATCTAATTGCACCAGAGTATGGATTCAAAATATCGAAAAGAGGTAGTTCAGGGATCATGAAAACAGAAGGAACACTTGA
GAACTGTGAGACCAAATGCCAAACTCCTTTGGGAGCAATAAATACAACATTGCCTTTTCACAATGTCCACCCACTGACAATAGGTGAGTG
CCCCAAATATGTAAAATCGGAGAAGTTGGTCTTAGCAACAGGACTAAGGAATGTTCCCCAGATTGAATCAAGAGGATTGTTTGGGGCAAT
AGCTGGTTTTATAGAAGGAGGATGGCAAGGAATGGTTGATGGTTGGTATGGATACCATCACAGCAATGACCAGGGATCAGGGTATGCAGC
AGACAAAGAATCCACTCAAAAGGCATTTGATGGAATCACCAACAAGGTAAATTCTGTGATTGAAAAGATGAACACCCAATTTGAAGCTGT
TGGGAAAGAATTCAGTAACTTAGAGAGAAGACTGGAGAACTTGAACAAAAAGATGGAAGACGGGTTTCTAGATGTGTGGACATACAATGC
TGAGCTTCTAGTTCTGATGGAAAATGAGAGGACACTTGACTTTCATGATTCTAATGTCAAGAATCTGTATGATAAAGTCAGAATGCAGCT
GAGAGACAACGTCAAAGAACTAGGAAATGGATGTTTTGAATTTTATCACAAATGTGATGATGAATGCATGAATAGTGTGAAAAACGGGAC
GTATGATTATCCCAAGTATGAAGAAGAGTCTAAACTAAATAGAAATGAAATCAAAGGGGTAAAATTGAGCAGCATGGGGGTTTATCAAAT
CCTTGCCATTTATGCTACAGTAGCAGGTTCTCTGTCACTGGCAATCATGATGGCTGGGATCTCTTTCTGGATGTGCTCCAACGGGTCTCT
GCAGTGCAGGATCTGCATATGA
TTATAAGTCATTTTATAATTAAAAACACCCTTGTTTCTACT
GenBank link View GenBank Entry (at NCBI)

Protein Record
Accession:AAA43248
GI:408525
Definition:hemagglutinin [Influenza A virus (A/Krasnodar/101/59 (H2N2))]
Length:562
Sequence:
GenBank link View GeneBank Entry (at NCBI)