Nucleotide Record
Accession: DQ863510 
GI: 112418208 
Strain: A/grebe/Tyva/Tyv06-8/2006(H5N1) 
Definition: Influenza A virus (A/Grebe/Tyva/Tyv06-8/2006(H5N1)) polymerase basic protein 2 (PB2) gene, complete cds. 
Country: Russia 
District: Tyva 
Host: Avian 
Organism: Grebe 
Segment: PB2 
Type: A 
Subtype: H5N1 
Year: 2006 
Length: 2316 
Full-length: Yes 
Q-Filter Category: C4 
CDS length:2280
CDS range:16-2295
Sequence:TCAAATATATTCAATATGGAGAGAATAAAGGAATTAAGAGATCTAATGTCACAGTCCCGCACTCGCGAGATACTAACAAAGACCACTGTG
GACCATATGGCCATAATCAAGAAATACACATCAGGAAGACAAGAGAAGAACCCTGCTCTCAGAATGAAATGGATGATGGCAATGAAATAT
CCAATCACAGCGGACAAGAGAATAATAGAGATGATTCCTGAAAGGAATGAACAAGGACAGACACTCTGGAGCAAGACAAATGATGCTGGA
TCGGACAGGGTGATGGTGTCTCCCCTAGCTGTAACTTGGTGGAATAGGAATGGGCCGACGACAAGTACAGTTCATTATCCAAAGGTTTAC
AAAACATACTTTGAGAAGGTTGAAAGGTTAAAACATGGAACCTTCGGTCCCGTTCATTTCCGAAACCAAGTTAAAATACGCCGCCGAGTT
GATACAAATACTGGCCATGCAGATCTCAGTGCTAAAGAAGCACAAGATGTCATCATGGAGGTCGTTTTCCCAAATGAAGTGGGAGCTAGA
ATATTGACTTCAGAGTCACAATTGACAATAACGAAAGAGAAGAAAGAAGAGCTCCAAGATTGTAAGATTGCTCCCTTAATGGTTGCATAC
ATGTTGGAAAGGGAACTGGTCCGCAAAACCAGATTCCTACCAGTAGCAGGCGGAACAAGCAGTGTGTACATTGAGGTATTGCATTTGACT
CAAGGAACCTGCTGGGAACAGATGTACACTCCGGGCGGAGAAGTAAGAAATGACGATGTTGACCAGAGTTTGATCATTGCTGCCAGAAAC
ATTGTTAGGAGAGCAACGGTATCAGCGGATCCACTGGCATCACTGCTGGAGATGTGTCACAGCACACAAATTGGTGGGATAAGGATGGTG
GACATCCTTAGGCAAAATCCAACTGAGGAACAAGCTGTGGATATATGCAAAGCAGCAATGGGTCTGAGGATTAGTTCATCCTTTAGCTTT
GGAGGCTTCACTTTCAAAAGAACAAGTGGATCATCCGTCACGAAGGAAGAGGAAGTGCTTACAGGCAACCTCCAAACATTGAAAATAAGA
GTACATGAGGGGTATGAGGAATTCACAATGGTTGGGCAGAGGGCAACAGCTATCCTGAGGAAAGCAACTAGAAGGCTGATTCAGTTGATA
GTAAGTGGAAGAAACGAACAATCAATCGCTGAGGCAATCATTGTAGCAATGGTGTTCTCACAGGAGGATTGCATGATAAAAGCAGTCCGA
GGCGATCTGAATTTCGTAAACAGAGCAAACCAAAGATTAAACCCCATGCATCAACTCCTGAGACATTTTCAAAAGGACGCAAAAGTGCTA
TTTCAGAATTGGGGAACTGAGCCCATTGATAATGTCATGGGGATGATCGGAATATTACCTGACATGACTCCCAGCACAGAAACGTCACTG
AGAGGAGTAAGAGTTAGTAAAATGGGAGTAGATGAGTATTCCAGCACTGAGAGAGTAGTTGTAAGCATTGACCGCTTCTTAAGGGTTCGA
GACCAGCGGGGGAACGTACTCTTATCTCCCGAAGAGGTCAGCGAAACCCAGGGAACAGAGAAGTTGACAATAACATATTCATCATCAATG
ATGTGGGAAATCAACGGTCCTGAGTCAGTGCTTGTTAACACTTACCAATGGATCATCAGAAACTGGGAGACCGTGAAAATTCAGTGGTCT
CAGGACCCCACGATGTTGTACAATAAGATGGAGTTTGAACCGTTCCAATCCTTGGTACCTAAAGCTGCCAGAGGTCAATACAGTGGATTT
GTGAGAACATTATTCCAACAAATGCGTGACGTACTGGGGACATTTGATACTGTCCAGATAATAAAGCTGCTACCATTTGCAGCAGCCCCA
CCGAAGCAGAGCAGAATGCAGTTTTCTTCTCTAACTGTGAATGTGAGAGGCTCAGGAATGAGAATACTCATAAGGGGCAATTCCCCTGTG
TTCAACTACAATAAGGCAACCAAAAGACTTACCGTTCTTGGAAAGGACGCAGGTGCATTAACAGAGGATCCAGATGAGGGGACAGCCGGA
GTGGAATCTGCAGTACTGAGGGGGTTCCTAATTCTAGGCAAGGAGGACAAAAGATATGGACCAGCATTGAGCATCAATGAACTGAGCAAT
CTTGCAAAAGGGGAGAAAGCTAATGTGCTGATAGGGCAAGGAGACGTGGTGTTGGTAATGAAACGGAAACGGGACTCTAGCATACTTACT
GACAGCCAGACAGCGACCAAAAGAATTCGGATGGCCATCAATTAG
TGTCGAATTGTTTAAAAACGA
GenBank link View GenBank Entry (at NCBI)

Protein Record
Accession:ABI18105
GI:112418209
Definition:polymerase basic protein 2 [Influenza A virus (A/Grebe/Tyva/Tyv06-8/2006(H5N1))]
Length:759
Sequence:
GenBank link View GeneBank Entry (at NCBI)