Nucleotide Record
Accession: DQ863509 
GI: 112418206 
Strain: A/grebe/Tyva/Tyv06-8/2006(H5N1) 
Definition: Influenza A virus (A/Grebe/Tyva/Tyv06-8/2006(H5N1)) polymerase basic protein 1 (PB1) gene, complete cds. 
Country: Russia 
District: Tyva 
Host: Avian 
Organism: Grebe 
Segment: PB1 
Type: A 
Subtype: H5N1 
Year: 2006 
Length: 2316 
Full-length: Yes 
Q-Filter Category: C4 
CDS length:2274
CDS range:13-2286
Sequence:CAAACCATTTGAATGGATGTCAATCCGACTTTACTTTTCTTGAAAGTACCAGTGCAAAATGCTATAAGTACCACATTCCCTTATACCGGA
GACCCTCCATACAGCCATGGGACAGGGACAGGATACACCATGGACACAGTCAACAGAACACACCAATATTCAGAAAAGGGGAAGTGGACA
ACAAACACAGAGACTGGAGCACCCCAACTCAACCCGATTGATGGACCACTACCTGAGGATAATGAGCCCAGTGGTTATGCACAAACAGAT
TGTGTATTGGAAGCAATGGCTTTCCTTGAAGAATCCCACCCAGGGATCTTTGAAAACTCGTGTCTTGAAACGATGGAAATTGTTCAACAA
ACAAGAGTGGATAAACTGACCCAAGGTCGTCAGACCTATGACTGGACATTGAATAGAAACCAACCGGCTGCAACCGCTTTGGCCAACACT
ATAGAAATCTTCAGATCGAACGGTCTAACAGCCAATGAATCGGGACGGCTAATAGATTTCCTCAAGGATGTGATGGAATCAATGGATAAG
GAAGAAATGGAGATAATAACACATTTCCAGAGAAAGAGAAGAGTGAGAGACAACATGACCAAAAAGATGGTCACACAAAGAACAATAGGG
AAGAAAAAACAAAGGCTGAACAAAAAGAGCTACCTGATAAGAGCACTGACACTGAATACAATGACAAAAGATGCAGAAAGAGGCAAATTG
AAGAGGCGAGCAATTGCAACACCCGGAATGCAAATCAGAGGATTCGTGTACTTTGTTGAAACATTAGCGAGGAGTATCTGTGAGAAACTT
GAGCAATCTGGACTCCCAGTTGGAGGGAATGAGAAGAAGGCTAAATTGGCAAACGTCGTGAGGAAGATGATGACTAACTCACAAGATACT
GAACTCTCCTTTACAATTACTGGAGACAATACTAAATGGAATGAGAATCAGAATCCTAGGATGTTTCTGGCAATGATAACATACATCACA
AGGAACCAGCCAGAATGGTTTCGGAATGTCTTAAGCATTGCCCCTATAATGTTCTCAAACAAAATGGCAAGATTAGGAAGAGGATACATG
TTCGAAAGTAAGAGCATGAAGTTGCGAACACAAATACCAGCAGAAATGCTTGCAAACATTGATCTTAAATACTTCAATGAATTAACGAAA
AAGAAAATTGAAAAAATAAGACCTCTATTAATAGATGGTACAGCCTCATTGAGCCCTGGAATGATGATGGGCATGTTCAACATGCTGAGT
ACAGTTCTGGGAGTCTCAATCTTGAACCTTGGACAGAAAAGGTACACCAAAACCACATATTGGTGGGACGGACTCCAATCCTCTGATGAT
TTCGCTCTCATCTTAAATGCACCGAATCATGAGGGAATACAAGCAGGAGTGGATAGATTTTATAGGACTTGTAAATTAGTTGGAATCAAC
ATGAGCAAGAAGAAGTCTTACATAAATCGGACAGGGACATTTGAATTCACGAGCTTTTTCTACCGCTATGGATTTGTAGCCAATTTCAGT
ATGGAGCTGCCCAGTTTGGGAGTGTCTGGAATTAATGAATCAGCCGACATGAGCATTGGTGTTACAGTGATAAAGAACAATATGATAAAC
AACGACCTTGGGCCAGCAACAGCTCAGATGGCTCTTCAGCTATTCATCAAGGACTACAGATACACATACCGATGCCACAGAGGGGATACG
CAAATCCAAACGAGGAGATCATTCGAGCTGAAGAAGCTGTGGGAGCAAACCCGTTCAAAGGCAGGACTGTTGGTTTCAGATGGAGGACCA
AATCTATACAATATCCGAAATCTCCATATTCCTGAGGTCTGCTTGAAATGGGAATTGATGGATGAAGATTACCAGGGCAGACTGTGTAAT
CCTCTGAATCCGTTCGTCAGCCATAAGGAAATTGAATCTGTCAACAATGCTGTAGTAATGCCAGCTCATGGCCCGGCCAAGAGTATGGAA
TATGATGCCGTTGCAACTACGCATTCATGGATTCCTAAAAGGAATCGTTCCATTCTCAATACGAGTCAAAGGGGAATTCTTGAGGATGAA
CAGATGTACCAGAAGTGCTGCAATCTATTCGAGAAATTCTTCCCCAGCAGTTCATATCGGAGGCCAGTTGGAATTTCCAGCATGGTGGAG
GCCATGGTGTCTAGGGCCCGAATTGACGCACGAATCGATTTCGAGTCTGGAAGGATTAAGAAAGAAGAGTTTGCTGAGATCATGAAGATC
TGTTCCACCATTGAAGAGCTCAGACGGCCAAAATAG
TGAATTTAGCTTGTCCTTCGTGAAAAAATG
GenBank link View GenBank Entry (at NCBI)

Protein Record
Accession:ABI18104
GI:112418207
Definition:polymerase basic protein 1 [Influenza A virus (A/Grebe/Tyva/Tyv06-8/2006(H5N1))]
Length:757
Sequence:
GenBank link View GeneBank Entry (at NCBI)