Nucleotide Record
Accession: DQ863507 
GI: 112418202 
Strain: A/grebe/Tyva/Tyv06-8/2006(H5N1) 
Definition: Influenza A virus (A/Grebe/Tyva/Tyv06-8/2006(H5N1)) neuraminidase (NA) gene, complete cds. 
Country: Russia 
District: Tyva 
Host: Avian 
Organism: Grebe 
Segment: NA 
Type: A 
Subtype: H5N1 
Year: 2006 
Length: 1373 
Full-length: Yes 
Q-Filter Category: C4 
CDS length:1350
CDS range:9-1358
Sequence:AGTTCAAAATGAATCCAAATCAGAAGATAATAACCATCGGATCAATCTGTATGGTAATTGGAATAGTTAGCTTAATGTTACAAATTGGGA
ACATGATCTCAATATGGGTCAGTCATTCAATTCAGACAGGGAATCAACGCCAAGCTGAATCAATTAGCAATACTAAATTTCTTACTGAGA
AAGCTGTGGCTTCAGTAACATTAGCGGGCAATTCATCTCTTTGCCCCATTAGCGGATGGGCTGTATACAGTAAGGACAACAGTATAAGGA
TCGGTTCCAGGGGGGATGTGTTTGTTATAAGAGAGCCGTTCATTTCATGCTCCCACTTGGAATGCAGAACTTTCTTTTTGACTCAGGGAG
CCTTGCTGAATGACAAGCACTCCAATGGGACTGTCAAAGACAGAAGCCCTCACAGAACATTAATGAGTTGTCCTGTGGGTGAGGCTCCCT
CCCCATATAACTCAAGGTTTGAGTCTGTTGCTTGGTCAGCAAGTGCTTGCCATGATGGCACCAGTTGGTTGACAATTGGAATTTCTGGTC
CAGACAATGGGGCTGTGGCTGTATTGAAATACAATGGCATAATAACAGACACCATCAAGAGTTGGAGGAACAACATACTGAGAACCCAAG
AGTCTGAATGTGCATGTGTAAATGGCTCTTGCTTTACTGTAATGACTGATGGACCAAGTAATGGGCAGGCATCATATAAGATCTTCAAAA
TGGAAAAAGGGAAAGTGGTTAAATCAGTCGAATTGGATGCTCCTAATTATCACTATGAGGAGTGCTCCTGTTATCCTGATGCCGGCGAGA
TCACATGTGTGTGCAGGGATAATTGGCATGGCTCAAATAGGCCATGGGTATCTTTCAATCAAAATTTGGAGTATCAAATAGGATATATAT
GCAGTGGAGTTTTCGGAGACAATCCACGCCCCAATGATGGAACAGGTAGTTGTGGTCCGGTGTCCCTTAACGGGGCATATGGGGTAAAAG
GGTTTTCATTTAAATACGGCAATGGTGTTTGGATTGGGAGAACCAAAAGCACTAATTCCAGGAGCGGCTTTGAAATGATTTGGGATCCAA
ATGGGTGGACTGGAACGGACAGTAGCTTTTCGGTGAAGCAAGATATCGTAGCAATAACTGATTGGTCAGGATATAGCGGGAGTTTTGTCC
AGCATCCAGAATTGACAGGATTAGATTGCATAAGACCTTGTTTCTGGGTTGAGTTAATCAGAGGGCGGCCTAAAGAGAGCACAATTTGGA
CCAGTGGGAGCAGCATATCTTTTTGTGGTGTAAATAGTGACACTGTTAGTTGGTCTTGGCCAGACGGTGCTGAATTGCCATTCACCATTG
ACAAGTAG
TTTGTTCAAAAAACT
GenBank link View GenBank Entry (at NCBI)

Protein Record
Accession:ABI18102
GI:112418203
Definition:neuraminidase [Influenza A virus (A/Grebe/Tyva/Tyv06-8/2006(H5N1))]
Length:449
Sequence:
GenBank link View GeneBank Entry (at NCBI)