Nucleotide Record
Accession: DQ863505 
GI: 112418197 
Strain: A/grebe/Tyva/Tyv06-8/2006(H5N1) 
Definition: Influenza A virus (A/Grebe/Tyva/Tyv06-8/2006(H5N1)) nonstructural protein 2 and nonstructural protein 1 (NS) gene, complete cds. 
Country: Russia 
District: Tyva 
Host: Avian 
Organism: Grebe 
Segment: NS 
Type: A 
Subtype: H5N1 
Year: 2006 
Length: 850 
Full-length: Yes 
Q-Filter Category: C4 
CDS length:678
CDS range:15-692
Sequence:GTGACAAAAACATAATGGATTCCAACACAGTGTCAAGCTTTCAGGTAGACTGCTTTCTTTGGCATGTCCGCAAACGATTTGCAGACCAAG
AACTGGGTGATGCCCCATTCCTTGACCGGCTTCGCCGAGATCAGAAGTCCCTAAGAGGAAGGGGCAACACTCTTGGTCTGGACATCGAAA
CAGCTACTCGTGCGGGAAAGCAGATAGTGGAGCGAATTCTGGAGGAGGAGTCTGATGAGGCACTTAAAATGCCAGCTTCACGCTACTTAA
CTGATATGACTCTCGAGGAAATGTCAAGGGACTGGTTCATGCTCATGCCTAAGCAGAAAGTGACAGGTTCCCTTTGCATCAAAATGGACC
AGGCAATAATGGATAAAACCATCATATTGAAAGCAAACTTCAGTGTGATTTATGACCGGTTAGAGACCCTAATACTACTTAGAGCTTTCA
CAGAAGAAGGAGCAATCGTGGGAGAAATCTCACCATTACCTTCTCTTCCAGGACATACTAATGAGGATGTCAAAAATGCAATTGGCGTCC
TCATCGGAGGACTTGAATGGAATGATAACACAGTTCGAGTCTCTGAAATTATACAGAGATTCGCTTGGAGAAGCATTGGTGAGGATGGGA
GACTTCCACTCCCTCCAGACCAGAAACGGAAAATGGCGAGAACAATTGAGTCAAAAGTTTGA
AGAAATAAGGTGGCTGATTGAAGAAATA
CGACATAGATTGAAAATTACAGAAAACAGCTTCGAACAGATAACGTTTATGCAAGCCTTACAACTACTGCTTGAAGTGGAGCAAGAGATA
AGAACCTTCTCGTTTCAGCTTATTTAGTAATAAAAAACAC
CDS length:366
CDS range:15-44, 502-837
Sequence:GTGACAAAAACATAATGGATTCCAACACAGTGTCAAGCTTTCAGGTAGACTGCTTTCTTTGGCATGTCCGCAAACGATTTGCAGACCAAG
AACTGGGTGATGCCCCATTCCTTGACCGGCTTCGCCGAGATCAGAAGTCCCTAAGAGGAAGGGGCAACACTCTTGGTCTGGACATCGAAA
CAGCTACTCGTGCGGGAAAGCAGATAGTGGAGCGAATTCTGGAGGAGGAGTCTGATGAGGCACTTAAAATGCCAGCTTCACGCTACTTAA
CTGATATGACTCTCGAGGAAATGTCAAGGGACTGGTTCATGCTCATGCCTAAGCAGAAAGTGACAGGTTCCCTTTGCATCAAAATGGACC
AGGCAATAATGGATAAAACCATCATATTGAAAGCAAACTTCAGTGTGATTTATGACCGGTTAGAGACCCTAATACTACTTAGAGCTTTCA
CAGAAGAAGGAGCAATCGTGGGAGAAATCTCACCATTACCTTCTCTTCCAGGACATACTAATGAGGATGTCAAAAATGCAATTGGCGTCC
TCATCGGAGGACTTGAATGGAATGATAACACAGTTCGAGTCTCTGAAATTATACAGAGATTCGCTTGGAGAAGCATTGGTGAGGATGGGA
GACTTCCACTCCCTCCAGACCAGAAACGGAAAATGGCGAGAACAATTGAGTCAAAAGTTTGAAGAAATAAGGTGGCTGATTGAAGAAATA
CGACATAGATTGAAAATTACAGAAAACAGCTTCGAACAGATAACGTTTATGCAAGCCTTACAACTACTGCTTGAAGTGGAGCAAGAGATA
AGAACCTTCTCGTTTCAGCTTATTTAG
TAATAAAAAACAC
GenBank link View GenBank Entry (at NCBI)

Protein Record
Accession:ABI18099
GI:112418198
Definition:nonstructural protein 1 [Influenza A virus (A/Grebe/Tyva/Tyv06-8/2006(H5N1))]
Length:225
Sequence:
GenBank link View GeneBank Entry (at NCBI)
Accession:ABI18100
GI:112418199
Definition:nonstructural protein 2 [Influenza A virus (A/Grebe/Tyva/Tyv06-8/2006(H5N1))]
Length:121
Sequence:
GenBank link View GeneBank Entry (at NCBI)