Nucleotide Record
Accession: DQ863504 
GI: 112418194 
Strain: A/grebe/Tyva/Tyv06-8/2006(H5N1) 
Definition: Influenza A virus (A/Grebe/Tyva/Tyv06-8/2006(H5N1)) matrix protein 2 and matrix protein 1 (M) gene, complete cds. 
Country: Russia 
District: Tyva 
Host: Avian 
Organism: Grebe 
Segment: M 
Type: A 
Subtype: H5N1 
Year: 2006 
Length: 1002 
Full-length: Yes 
Q-Filter Category: C4 
CDS length:294
CDS range:14-39, 728-995
Sequence:TAGATGTTGAAAGATGAGTCTTCTAACCGAGGTCGAAACGTACGTTCTCTCTATCATCCCGTCAGGCCCCCTCAAAGCCGAGATCGCACA
GAAACTTGAAGATGTCTTTGCAGGAAAGAACACCGATCTCGAGGCTCTCATGGAGTGGCTAAAGACAAGACCAATCCTGTCACCTTTGAC
TAAAGGGATGTTGGGATTTGTATTCACGCTCACCGTGCCCAGTGAGCGAGGACTGCAGCGTAGACGCTTTGTCCAGAATGCCCTAAATGG
AAATGGAGATCCAAATAATATGGATAGGGCAGTTAAGCTATATAAGAAGCTGAAAAGAGAAATAACATTCCATGGGGCTAAGGAGGTCGC
ACTCAGCTACTCAACCGGTGCACTCGCCAGTTGCATGGGTCTCATATACAACAGAATGGGCACAGTGACTACGGAAGTGGCTTTTGGCCT
AGTGTGTGCCACTTGTGAGCAGATTGCAGATTCACAGCATCGGTCTCACAGACAGATGGCAACTATCACCAACCCACTAATCAGGCATGA
GAACAGAATGGTGCTGGCAAGCACTACAGCTAAGGCTATGGAGCAGATGGCGGGATCAAGTGAGCAGGCAGCGGAAGCCATGGAGGTCGC
TAATCAGGCTAGGCAGATGGTGCAGGCAATGAGAACAATTGGGACTCATCCTAACTCTAGTGCTGGTCTGAGAGATAATCTTCTTGAAAA
TTTGCAGGCCTACCAGAAACGAATGGGAGTGCAGATGCAGCGATTCAAGTGATCCTCTTGTTGTTGCCGCAAGTATCATTGGGATCTTGC
ACTTGATATTGTGGATTCTTGATCGTCTTTTCTTCAAATGCATTTATCGTCGCCTTAAATACGGTTTGAAAAGAGGGCCTTCTACGGAAG
GAGTACCTGAGTCTATGAGGGAAGAGTATCGGCAGGAACAGCAGAATGCTGTAGATGTTGACGATGGTCATTTTGTCAACATAGAATTGG
AGTAA
AAAACTA
CDS length:759
CDS range:14-772
Sequence:TAGATGTTGAAAGATGAGTCTTCTAACCGAGGTCGAAACGTACGTTCTCTCTATCATCCCGTCAGGCCCCCTCAAAGCCGAGATCGCACA
GAAACTTGAAGATGTCTTTGCAGGAAAGAACACCGATCTCGAGGCTCTCATGGAGTGGCTAAAGACAAGACCAATCCTGTCACCTTTGAC
TAAAGGGATGTTGGGATTTGTATTCACGCTCACCGTGCCCAGTGAGCGAGGACTGCAGCGTAGACGCTTTGTCCAGAATGCCCTAAATGG
AAATGGAGATCCAAATAATATGGATAGGGCAGTTAAGCTATATAAGAAGCTGAAAAGAGAAATAACATTCCATGGGGCTAAGGAGGTCGC
ACTCAGCTACTCAACCGGTGCACTCGCCAGTTGCATGGGTCTCATATACAACAGAATGGGCACAGTGACTACGGAAGTGGCTTTTGGCCT
AGTGTGTGCCACTTGTGAGCAGATTGCAGATTCACAGCATCGGTCTCACAGACAGATGGCAACTATCACCAACCCACTAATCAGGCATGA
GAACAGAATGGTGCTGGCAAGCACTACAGCTAAGGCTATGGAGCAGATGGCGGGATCAAGTGAGCAGGCAGCGGAAGCCATGGAGGTCGC
TAATCAGGCTAGGCAGATGGTGCAGGCAATGAGAACAATTGGGACTCATCCTAACTCTAGTGCTGGTCTGAGAGATAATCTTCTTGAAAA
TTTGCAGGCCTACCAGAAACGAATGGGAGTGCAGATGCAGCGATTCAAGTGA
TCCTCTTGTTGTTGCCGCAAGTATCATTGGGATCTTGC
ACTTGATATTGTGGATTCTTGATCGTCTTTTCTTCAAATGCATTTATCGTCGCCTTAAATACGGTTTGAAAAGAGGGCCTTCTACGGAAG
GAGTACCTGAGTCTATGAGGGAAGAGTATCGGCAGGAACAGCAGAATGCTGTAGATGTTGACGATGGTCATTTTGTCAACATAGAATTGG
AGTAAAAAACTA
GenBank link View GenBank Entry (at NCBI)

Protein Record
Accession:ABI18098
GI:112418196
Definition:matrix protein 2 [Influenza A virus (A/Grebe/Tyva/Tyv06-8/2006(H5N1))]
Length:97
Sequence:
GenBank link View GeneBank Entry (at NCBI)
Accession:ABI18097
GI:112418195
Definition:matrix protein 1 [Influenza A virus (A/Grebe/Tyva/Tyv06-8/2006(H5N1))]
Length:252
Sequence:
GenBank link View GeneBank Entry (at NCBI)