Nucleotide Record
Accession: DQ863503 
GI: 112418192 
Strain: A/grebe/Tyva/Tyv06-8/2006(H5N1) 
Definition: Influenza A virus (A/Grebe/Tyva/Tyv06-8/2006(H5N1)) hemagglutinin (HA) gene, complete cds. 
Country: Russia 
District: Tyva 
Host: Avian 
Organism: Grebe 
Segment: HA 
Type: A 
Subtype: H5N1 
Year: 2006 
Length: 1754 
Full-length: Yes 
Q-Filter Category: C4 
CDS length:1707
CDS range:17-1723
Sequence:GGTTCAATCTGTCAAAATGGAGAAAATAGTGCTTCTTCTTGCAATAATCAGTCTTGTTAAAAGTGATCAGATTTGCATTGGTTACCATGC
AAACAACTCTACAGAGCAGGTTGACACAATAATGGAAAAGAACGTCACTGTTACACACGCCCAAGACATACTGGAAAAGACACACAACGG
GAAGCTCTGCGATCTAGACGGGGTGAAGCCTTTAATTTTAAGAGATTGTAGTGTAGCTGGATGGCTCCTCGGGAATCCAATGTGTGACGA
ATTCCTCAATGTGCCGGAATGGTCTTACATAGTGGAGAAGATCAATCCAGCCAATGACCTCTGTTACCCAGGGAATTTCAACGACTATGA
AGAACTGAAACACCTATTGAGCAGAATAAACCATTTTGAGAAAATTCAGATCATCCCCAGAAGTTCTTGGTCAGATCATGAAGCCTCATC
AGGGGTGAGCTCAGCATGTCCATACCAGGGAAGGTCCTCCTTTTTTAGAAATGTGGTATGGCTTATCAAAAAGAACGATGCATACCCAAC
AATAAAGAGAAGTTACAATAATACCAACCAAGAAGATCTTTTGGTACTGTGGGGGATTCACCATCCAAATGATGCGGCAGAGCAGACAAG
GCTCTATCAAAACCCAACCACCTATATTTCCGTTGGGACATCAACACTAAACCAGAGATTGGTACCAAAAATAGCTACTAGATCCAAGGT
AAACGGGCAAAGTGGAAGGATGGAGTTCTTTTGGACAATTTTAAAACCGAATGATGCAATAAATTTTGAGAGTAATGGAAATTTCATTGC
TCCAGAAAATGCATACAAAATTGTCAAGAAAGGGGACTCAACAATCATGAAAAGTGAATTGGAATATGGTAACTGCAACACCAAGTGTCA
AACTCCAATAGGGGCGATAAACTCTAGTATGCCATTCCACAACATCCACCCTCTCACCATCGGGGAATGCCCCAAATATGTGAAATCAAA
CAGATTAGTCCTTGCGACTGGGCTTAGAAATAGCCCTCAAGGAGAGAGAAGAAGAAAAAAGAGAGGACTATTTGGAGCTATAGCAGGTTT
TATAGAGGGAGGATGGCAGGGAATGGTAGATGGTTGGTATGGGTACCACCATAGCAACGAGCAGGGGAGTGGGTACGCTGCAGACAAAGA
ATCCACTCAAAAGGCAATAGATGGAGTCACCAATAAGGTCAACTCGATCATTGACAAAATGAACACTCAGTTTGAGGCCGTCGGAAGGGA
ATTTAATAACTTAGAAAGGAGAATAGAGAATTTAAACAAGAAGATGGAAGACGGATTTCTAGATGTCTGGACTTATAATGCTGAACTTCT
GGTTCTCATGGAAAATGAGAGAACTCTAGACTTTCATGACTCAAATGTCAAGAACCTTTACGACAAGGTCCGACTACAGCTTAGGGATAA
TGCAAAGGAGCTTGGTAACGGTTGTTTCGAGTTCTATCACAGATGTGATAATGAATGTATGGAAAGTGTAAGAAACGGAACGTATGACTA
CCCGCAGTATTCAGAAGAATCAAGATTAAAAAGAGAGGAAATAAGTGGAGTAAAATTGGAATCAATAGGAACTTATCAAATACTGTCAAT
TTATTCAACAGTGGCGAGCTCCCTAGCACTGGCAATCATGGTGGCTGGTCTATCTTTATGGATGTGCTCCAATGGATCGTTACAATGCAG
AATTTGCATTTAA
ATTTGTGAGTTCAGATTGTAGTTAAAAACAC
GenBank link View GenBank Entry (at NCBI)

Protein Record
Accession:ABI18096
GI:112418193
Definition:hemagglutinin [Influenza A virus (A/Grebe/Tyva/Tyv06-8/2006(H5N1))]
Length:568
Sequence:
GenBank link View GeneBank Entry (at NCBI)