Nucleotide Record
Accession: DQ399542 
GI: 89077647 
Strain: A/Cygnus olor/Astrakhan/Ast05-2-8/2005(H5N1) 
Definition: Influenza A virus (A/Cygnus olor/Astrakhan/Ast05-2-8/2005(H5N1)) membrane ion channel M2 and matrix protein 1 (M) gene, complete cds. 
Country: Russia 
District: Astrakhan 
Host: Avian 
Organism: Cygnus Olor 
Segment: M 
Type: A 
Subtype: H5N1 
Year: 2005 
Length: 1002 
Full-length: Yes 
Q-Filter Category: C4 
CDS length:759
CDS range:14-772
Sequence:TAGATGTTGAAAGATGAGTCTTCTAACCGAGGTCGAAACGTACGTTCTCTCTATCATCCCGTCAGGCCCCCTCAAAGCCGAGATCGCGCA
GAAACTTGAAGATGTCTTTGCAGGAAAGAACACCGATCTCGAGGCTCTCATGGAGTGGCTAAAGACAAGACCAATCCTGTCACCTCTGAC
TAAAGGGATGTTGGGATTTGTATTCACGCTCACCGTGCCCAGTGAGCGAGGACTGCAGCGTAGACGCTTTGTCCAGAATGCCCTAAATGG
AAATGGAGATCCAAATAATATGGATAGGGCAGTTAAGCTATATAAGAAGCTGAAAAGAGAAATAACATTCCATGGGGCTAAGGAGGTCGC
ACTCAGCTACTCAACCGGTGCACTCGCCAGTTGCATGGGTCTCATATACAACAGAATGGGCACAGTTACTACGGAAGTGGCTTTTGGCCT
AGTGTGTGCCACTTGTGAGCAGATTGCAGATTCACAGCATCGGTCTCACAGACAGATGGCAACTATCACCAACCCACTAATCAGGCATGA
GAACAGAATGGTGCTGGCCAGCACTACAGCTAAGGCTATGGAGCAGATGGCGGGATCAAGCGAGCAGGCAGCGGAAGCCATGGAGGTCGC
TAATCAGGCTAGGCAGATGGTGCAGGCAATGAGAACAATTGGGACTCATCCTAACTCTAGCGCTGGTCTGAGAGATAATCTTCTTGAAAA
TTTGCAGGCCTACCAGAAACGAATGGGAGTGCAGATACAGCGATTCAAGTGA
TCCTCTTGTTGTTGCCGCAAGTATCATTGGGATCTTGC
ACTTGATATTATGGATTCTTGATCGTCTTTTCTTCAAATGCATTTATCGTCGCCTTAAATACGGTTTGAAAAGAGGGCCTTCTACGGAAG
GAGTACCTGAGTCTATGAGGGAAGAGTATCGGCAGGAACAGCAGAATGCTGTGGATGTTGACGATGGTCATTTTGTCAACATAGAATTGG
AGTAAAAAACTA
CDS length:294
CDS range:14-39, 728-995
Sequence:TAGATGTTGAAAGATGAGTCTTCTAACCGAGGTCGAAACGTACGTTCTCTCTATCATCCCGTCAGGCCCCCTCAAAGCCGAGATCGCGCA
GAAACTTGAAGATGTCTTTGCAGGAAAGAACACCGATCTCGAGGCTCTCATGGAGTGGCTAAAGACAAGACCAATCCTGTCACCTCTGAC
TAAAGGGATGTTGGGATTTGTATTCACGCTCACCGTGCCCAGTGAGCGAGGACTGCAGCGTAGACGCTTTGTCCAGAATGCCCTAAATGG
AAATGGAGATCCAAATAATATGGATAGGGCAGTTAAGCTATATAAGAAGCTGAAAAGAGAAATAACATTCCATGGGGCTAAGGAGGTCGC
ACTCAGCTACTCAACCGGTGCACTCGCCAGTTGCATGGGTCTCATATACAACAGAATGGGCACAGTTACTACGGAAGTGGCTTTTGGCCT
AGTGTGTGCCACTTGTGAGCAGATTGCAGATTCACAGCATCGGTCTCACAGACAGATGGCAACTATCACCAACCCACTAATCAGGCATGA
GAACAGAATGGTGCTGGCCAGCACTACAGCTAAGGCTATGGAGCAGATGGCGGGATCAAGCGAGCAGGCAGCGGAAGCCATGGAGGTCGC
TAATCAGGCTAGGCAGATGGTGCAGGCAATGAGAACAATTGGGACTCATCCTAACTCTAGCGCTGGTCTGAGAGATAATCTTCTTGAAAA
TTTGCAGGCCTACCAGAAACGAATGGGAGTGCAGATACAGCGATTCAAGTGATCCTCTTGTTGTTGCCGCAAGTATCATTGGGATCTTGC
ACTTGATATTATGGATTCTTGATCGTCTTTTCTTCAAATGCATTTATCGTCGCCTTAAATACGGTTTGAAAAGAGGGCCTTCTACGGAAG
GAGTACCTGAGTCTATGAGGGAAGAGTATCGGCAGGAACAGCAGAATGCTGTGGATGTTGACGATGGTCATTTTGTCAACATAGAATTGG
AGTAA
AAAACTA
GenBank link View GenBank Entry (at NCBI)

Protein Record
Accession:ABD60339
GI:89077649
Definition:matrix protein 1 [Influenza A virus (A/Cygnus olor/Astrakhan/Ast05-2-8/2005(H5N1))]
Length:252
Sequence:
GenBank link View GeneBank Entry (at NCBI)
Accession:ABD60338
GI:89077648
Definition:membrane ion channel M2 [Influenza A virus (A/Cygnus olor/Astrakhan/Ast05-2-8/2005(H5N1))]
Length:97
Sequence:
GenBank link View GeneBank Entry (at NCBI)