Nucleotide Record
Accession: DQ394577 
GI: 88866838 
Strain: A/Cygnus olor/Astrakhan/Ast05-2-1/2005(H5N1) 
Definition: Influenza A virus (A/Cygnus olor/Astrakhan/Ast05-2-1/2005(H5N1)) nucleoprotein (NP) gene, complete cds. 
Country: Russia 
District: Astrakhan 
Host: Avian 
Organism: Cygnus Olor 
Segment: NP 
Type: A 
Subtype: H5N1 
Year: 2005 
Length: 1540 
Full-length: Yes 
Q-Filter Category: C4 
CDS length:1497
CDS range:34-1530
Sequence:GTAGATAATCACTCACTGAGTGACATCAACATCATGGCGTCTCAAGGCACCAAACGATCTTATGAACAGATGGAAACTGGTGGAGAACGC
CAGAATGCTACTGAGATCAGGGCATCTGTTGGAAGAATGATTAGTGGCATCGGGAGGTTCTACATACAGATGTGCACAGAACTCAAACTC
AGTGACTATGAAGGGAGGCTTATCCAGAACAGCATAACAATAGAGAGAATGGTACTCTCTGCATTTGATGAACGAAGGAACAGATACCTG
GAAGAACACCCCAGTGCGGGGAAGGACCCGAAGAAAACTGGAGGTCCAATTTATAGGAGGAGAGACGGGAAATGGGTGAGAGAGCTGATT
CTGCACGACAAAGAGGAGATCAGGAGGATTTGGCGTCAAGCGAACAATGGAGAGGACGCAACTGCTGGTCTCACCCACCTGATGATATGG
CATTCCAATCTAAATGATGCCACATATCAGAGAACGAGAGCTCTCGTACGTACTGGAATGGACCCCAGGATGTGCTCTCTGATGCAAGGG
TCAACTCTCCCGAGGAGATCTGGAGCTGCCGGTGCAGCAGTGAAGGGGGTAGGGACAATGGTAATGGAGCTGATTCGGATGATAAAACGA
GGGATCAACGACCGGAATTTCTGGAGAGGCGAAAATGGAAGAAGAACAAGGATTGCATATGAGAGAATGTGCAACATCCTCAAAGGGAAA
TTCCAAACAGCAGCACAAAGAGCAATGATGGATCAGGTGCGAGAGAGCAGAAATCCTGGGAATGCTGAAATTGAAGATCTCATTTTTCTG
GCACGGTCTGCACTCATCCTGAGAGGATCAGTAGCCCATAAGTCCTGCTTGCCTGCTTGTGTGTACGGACTTGCTGTGGCCAGTGGATAT
GACTTTGAGAGAGAAGGGTACTCTCTGGTTGGAATAGATCCTTTCCGTCTGCTTCAAAACAGCCAGGTCTTTAGTCTCATTAGACCAAAT
GAGAATCCGGCACATAAGAGTCAATTAGTGTGGATGGCATGCCACTCTGCAGCATTTGAGGACCTTAGAGTCTCAAGTTTCATCAGAGGG
ACAAGAGTGGTCCCAAGAGGACAGCTATCCACCAGAGGGGTTCAAATTGCTTCAAATGAGAACATGGAAGCAATGGACTCCAACACTCTT
GAACTGAGAAGTAAATATTGGGCTATAAGAACCAGAAGCGGAGGAAACACCAACCAGCAGAGGGCATCTGCAGGCCAGATAAGCATTCAG
CCCACTTTCTCGGTACAGAGAAACCTTCCATTCGAAAGAGCGACCATTATGGCAGCATTCACAGGAAATACTGAGGGCAGAACGTCTGAC
ATGAGAACTGAAATCATAAGAATGATGGAAAGTGCCAGACCAGAAGATGTGTCATTCCAGGGGCGGGGAGTCTTCGAGCTCTCGGACGAA
AAGGCAACGAACCCGATCGTGCCTTCCTTTGACATGAATAATGAAGGATCTTATTTCTTCGGAGACAATGCAGAGGAGTATGACAATTAA

AGAAAAATAC
GenBank link View GenBank Entry (at NCBI)

Protein Record
Accession:ABD57447
GI:88866839
Definition:nucleoprotein [Influenza A virus (A/Cygnus olor/Astrakhan/Ast05-2-1/2005(H5N1))]
Length:498
Sequence:
GenBank link View GeneBank Entry (at NCBI)