Nucleotide Record
Accession: DQ389161 
GI: 88714402 
Strain: A/Cygnus olor/Astrakhan/Ast05-2-1/2005(H5N1) 
Definition: Influenza A virus (A/Cygnus olor/Astrakhan/Ast05-2-1/2005(H5N1)) polymerase basic protein 2 (PB2) gene, complete cds. 
Country: Russia 
District: Astrakhan 
Host: Avian 
Organism: Cygnus Olor 
Segment: PB2 
Type: A 
Subtype: H5N1 
Year: 2005 
Length: 2316 
Full-length: Yes 
Q-Filter Category: C4 
CDS length:2280
CDS range:16-2295
Sequence:TCAAATATATTCAATATGGAGAGAATAAAGGAATTAAGAGATCTAATGTCACAGTCCCGCACTCGCGAGATACTAACAAAAACCACTGTG
GACCATATGGCCATAATCAAGAAATACACATCAGGAAGACAAGAGAAGAACCCCGCTCTCAGAATGAAATGGATGATGGCAATGAAATAT
CCAATCACAGCGGACAAGAGAATAATAGAAATGATTCCTGAAAGGAATGAACAGGGACAGACACTCTGGAGCAAGACAAATGATGCTGGA
TCGGACAGGGTGATGGTGTCTCCCCTAGCTGTAACTTGGTGGAATAGGAATGGGCCGACGACAAGTACAGTTCATTATCCAAAGGTTTAT
AAAACATACTTTGAGAAGGTTGAAAGGTTAAAACATGGAACCTTCGGTCCCGTTCATTTCCGAAACCAAGTTAAAATACGCCGCCGAGTT
GATACAAATCCTGGCCATGCAGATCTCAGTGCTAAAGAAGCACAAGATGTCATCATGGAGGTCGTTTTCCCAAATGAAGTGGGAGCTAGA
ATATTGACTTCAGAGTCACAATTGACAATAACGAAAGAGAAGAAAGAAGAGCTCCAAGATTGTAAGATTGCTCCCTTAATGGTTGCATAC
ATGTTGGAAAGGGAACTGGTCCGCAAAACCAGATTCCTACCGGTAGCAGGCGGAACAAGCAGTGTGTACATTGAGGTATTGCATTTGACT
CAAGGAACCTGCTGGGAACAGATGTACACTCCAGGCGGAGAAGTAAGAAATGACGATGTTGACCAGAGTTTGATCATTGCTGCCAGAAAC
ATTGTTAGGAGAGCAACGGTATCAGCGGATCCACTGGCATCACTGCTGGAGATGTGTCACAGCACACAAATTGGTGGGATAAGGATGGTG
GACATCCTTAGACAAAATCCAACTGAGGAACAAGCTGTGGATATATGCAAAGCAGCAATGGGTCTGAGGATTAGTTCATCCTTTAGCTTT
GGAGGCTTCACTTTCAAAAGAACAAGTGGATCATCCGTCACGAAAGAAGAGGAAGTTCTTACAGGCAACCTCCAAACATTGAAAATAAGA
GTACATGAGGGGTATGAGGAATTCACAATGGTTGGGCAGAGGGCAACAGCTATCCTGAGAAAAGCAACTAGAAGGCTGATTCAGTTGATA
GTAAGTGGAAGAAACGAACAATCAATCGCTGAGGCAATCATTGTAGCAATGGTGTTCTCACAGGAGGATTGCATGATAAAAGCAGTCCGA
GGCGATCTGAATTTCGTAAACAGAGCAAACCAAAGATTAAACCCCATGCATCAACTCCTGAGACATTTTCAAAAGGACGCAAAAGTGCTA
TTTCAGAATTGGGGAACTGAAACCATTGATAATGTCATGGGGATGATCGGAATATTACCTGACATGACTCCCAGCACAGAAATGTCACTG
AGAGGAGTAAGAGTTAGTAAAGTGGGAGTAGATGAATATTCCAGCACAGAGAGAGTAGTTGTAAGCATTGACCGCTTCTTAAGGGTTCGA
GACCAGCGGGGGAACGTACTCTTATCTCCCGAAGAGGTCAGCGAAAACCAGGGAACAGAGAAGTTGACAATAACATATTCATCATCAATG
ATGTGGGAAATCAACGGTCCTGAGTCAGTGCTTGTTAACACCTACCAATGGATCATCAGAAACTGGGAGACCGTGAAAATTCAGTGGTCT
CAAGATCCCACGATGTTGTACAATAAGATGGAGTTTGAACCGTTCCAATCCTTGGTACCTAAAGCTGCCAGAGGTCAATACAGTGGATTT
GTGAGAACATTATTCCAACAAATGCGTGACGTACTGGGGACATTTGATACTGTCCAGATAATAAAGCTGCTACCATTTGCAGCAGCCCCA
CCGAAGCAGAGCAGAATGCAGTTTTCTTCTCTAACTGTGAATGTAAGGGGCTCAGGAATGAGAATACTCATAAGGGGCAATTCCCCTGTG
TTCAACTACAATAAGGCAACCAAAAGACTTACCGTTCTTGGAAAGGACGCAGGTGCATTAACAGAGGATCCAGATGAGGGGACAGCCGGA
GTGGAATCTGCAGTACTGAGGGGGTTCCTAATTCTAGGCAAGGAGGACAAAAGGTATGGACCAGCATTGAGCATCAATGAACTGAGCAAT
CTTGCAAAAGGGGAGAAAGCTAATGTGCTGATAGGGCAAGGAGACGTGGTGTTGGTAATGAAACGGAAACGGGACTCTAGCATACTTACT
GACAGCCAGACAGCGACCAAAAGAATTCGGATGGCCATCAATTAG
TGTCGAATTGTTTAAAAACGA
GenBank link View GenBank Entry (at NCBI)

Protein Record
Accession:ABD49493
GI:88714403
Definition:polymerase basic protein 2 [Influenza A virus (A/Cygnus olor/Astrakhan/Ast05-2-1/2005(H5N1))]
Length:759
Sequence:
GenBank link View GeneBank Entry (at NCBI)