Nucleotide Record
Accession: DQ389159 
GI: 88714397 
Strain: A/Cygnus olor/Astrakhan/Ast05-2-1/2005(H5N1) 
Definition: Influenza A virus (A/Cygnus olor/Astrakhan/Ast05-2-1/2005(H5N1)) neuraminidase (NA) gene, complete cds. 
Country: Russia 
District: Astrakhan 
Host: Avian 
Organism: Cygnus Olor 
Segment: NA 
Type: A 
Subtype: H5N1 
Year: 2005 
Length: 1373 
Full-length: Yes 
Q-Filter Category: C4 
CDS length:1350
CDS range:9-1358
Sequence:AGTTCAAAATGAATCCAAATCAGAAGATAATAACCATCGGATCAATCTGTATGGTAATTGGAATAGTTAGCTTAATGTTACAAATTGGGA
ACATGATCTCAATATGGGTCAGTCATTCAATTCAGACAGGGAATCAACGCCAAGCTGAACCAATCAGCAATACTAAATTTCTTACTGAGA
AAGCTGTGGCTTCAGTAACATTAGCGGGCAATTCATCTCTTTGCCCCATTAGCGGATGGGCTGTATACAGTAAGGACAACAGTATAAGGA
TCGGTTCCAGGGGGGATGTGTTTGTTATAAGAGAGCCGTTCATCTCATGCTCCCACTTGGAATGCAGAACTTTCTTTTTGACTCAGGGAG
CCTTGCTGAATGACAAGCACTCCAATGGGACTGTCAAAGACAGAAGCCCTCACAGAACATTAATGAGTTGTCCTGTGGGTGAGGCTCCCT
CCCCATATAACTCAAGGTTTGAGTCTGTTGCTTGGTCAGCAAGTGCTTGCCATGATGGCACCAGTTGGTTGACAATTGGAATTTCTGGTC
CAGACAATGGGGCTGTGGCTGTATTGAAATACAATGGCATAATAACAGACACCATCAAGAGTTGGAGGAACAACATACTGAGAACTCAAG
AGTCTGAATGTGCATGTGTAAATGGCTCTTGCTTTACTGTAATGACTGATGGACCAAGTAATGGGCAGGCATCATATAAGATCTTCAAAA
TGGAAAAAGGGAAAGTGGTTAAATCAGTCGAATTGGATGCTCCTAATTATCACTATGAGGAGTGCTCCTGTTATCCTGATGCCGGCGAAA
TCACATGTGTGTGCAGGGATAATTGGCATGGCTCAAATAGGCCATGGGTATCTTTCAATCAAAATTTGGAGTATCAAATAGGATATATAT
GCAGTGGGGTTTTCGGAGACAATCCACGCCCCAATGATGGAACAGGTAGTTGTGGTCCGGTGTCCCCTAACGGGGCATATGGGGTAAAAG
GGTTTTCATTTAAATACGGCAATGGTGTCTGGATCGGGAGAACCAAAAGCACTAATTCCAGGAGCGGCTTTGAAATGATTTGGGATCCAA
ATGGGTGGACTGGAACGGACAGTAGCTTTTCGGTGAAGCAAGATATCGTAGCAATAACTGATTGGTCAGGATATAGCGGGAGTTTTGTCC
AGCATCCAGAACTGACAGGATTAGATTGCATAAGACCTTGTTTCTGGGTTGAGTTAATCAGAGGGCGGCCTAAAGAGAGCACAATTTGGA
CCAGTGGGAGCAGCATATCTTTTTGTGGTGTAAATAGTGACACTGTTAGTTGGTCTTGGCCAGACGGTGCTGAGTTGCCATTCACCATTG
ACAAGTAG
TTTGTTCAAAAAACT
GenBank link View GenBank Entry (at NCBI)

Protein Record
Accession:ABD49490
GI:88714398
Definition:neuraminidase [Influenza A virus (A/Cygnus olor/Astrakhan/Ast05-2-1/2005(H5N1))]
Length:449
Sequence:
GenBank link View GeneBank Entry (at NCBI)