Nucleotide Record
Accession: DQ365004 
GI: 86278736 
Strain: A/Cygnus olor/Astrakhan/Ast05-2-5/2005(H5N1) 
Definition: Influenza A virus (A/Cygnus olor/Astrakhan/Ast05-2-5/2005(H5N1)) hemagglutinin (HA) gene, complete cds. 
Country: Russia 
District: Astrakhan 
Host: Avian 
Organism: Cygnus Olor 
Segment: HA 
Type: A 
Subtype: H5N1 
Year: 2005 
Length: 1754 
Full-length: Yes 
Q-Filter Category: C4 
CDS length:1707
CDS range:17-1723
Sequence:GGTTCAATCTGTCAAAATGGAGAAAATAGTGCTTCTTTTTGCAATAGTCAGTCTTGTTAAAAGTGATCAGATTTGCATTGGTTACCATGC
AAACAACTCGACAGAGCAGGTTGACACAATAATGGAAAAGAACGTCACTGTTACACACGCCCAAGACATACTGGAAAAGACACACAACGG
GAAGCTCTGCGATCTAGATGGAGTGAAGCCTCTAATTTTAAGAGATTGTAGTGTAGCTGGATGGCTCCTCGGGAACCCAATGTGTGACGA
ATTCCTCAATGTGCCGGAATGGTCTTACATAGTGGAGAAGATCAATCCAGCCAATGACCTCTGTTACCCAGGGAATTTCAACGACTATGA
AGAACTGAAACACCTATTGAGCAGAATAAACCATTTTGAGAAAATTCAGATCATCCCCAAAAGTTCTTGGTCAGATCATGAAGCCTCATC
AGGGGTGAGCTCAGCATGTCCATACCAGGGAAGGTCCTCCTTTTTTAGAAATGTGGTATGGCTTATCAAAAAGGACAATGCATACCCAAC
AATAAAGAGAAGTTACAATAATACCAACCAAGAAGATCTTTTGGTACTGTGGGGGATTCACCATCCAAATGATGCGGCAGAGCAGACAAG
GCTCTATCAAAACCCAACCACCTATATTTCCGTTGGGACATCAACACTAAACCAGAGATTGGTACCAAAAATAGCTACTAGATCCAAGGT
AAACGGGCAAAGTGGAAGGATGGAGTTCTTTTGGACAATTTTAAAACCGAATGATGCAATAAACTTTGAGAGTAATGGAAATTTCATTGC
TCCAGAAAATGCATACAAAATTGTCAAGAAAGGGGACTCAACAATTATGAAAAGTGAATTGGAATATGGTAACTGCAACACCAAGTGTCA
AACTCCAATAGGGGCGATAAACTCTAGTATGCCATTCCACAACATCCACCCTCTCACCATCGGGGAATGCCCCAAATATGTGAAATCAAA
CAGATTAGTCCTTGCGACTGGGCTCAGAAATAGCCCTCAAGGAGAGAGAAGAAGAAAAAAGAGAGGACTATTTGGAGCTATAGCAGGTTT
TATAGAAGGAGGATGGCAGGGAATGGTAGATGGTTGGTATGGGTACCATCATAGCAACGAGCAGGGGAGTGGGTACGCTGCAGACAAAGA
ATCCACTCAAAAGGCAATAGATGGAGTCACCAATAAGGTCAACTCGATCATTGACAAAATGAACACTCAGTTTGAGGCCGTTGGAAGGGA
ATTTAATAACTTAGAAAGGAGAATAGAAAATTTAAACAAGAAGATGGAAGACGGATTCCTAGATGTCTGGACTTATAATGCTGAACTTCT
GGTTCTCATGGAAAATGAGAGAACTCTAGACTTTCATGACTCAAATGTCAAGAACCTTTACGACAAGGTCCGACTACAGCTTAGGGATAA
TGCAAAGGAACTTGGTAACGGTTGTTTCGAGTTCTATCACAGATGTGATAATGAATGTATGGAAAGTGTAAGAAACGGTACGTATGACTA
CCCGCAGTATTCAGAAGAAGCAAGATTAAAAAGAGAGGAAATAAGTGGAGTAAAATTGGAATCAATAGGAACCTACCAAATACTGTCAAT
TTATTCAACAGTGGCGAGCTCCCTAGCACTGGCAATCATGGTGGCTGGTCTATCTTTATGGATGTGCTCCAATGGATCGTTGCAATGCAG
AATTTGCATTTAA
ATTTGTGAGTTCAGATTGTAGTTAAAAACAC
GenBank link View GenBank Entry (at NCBI)

Protein Record
Accession:ABC88583
GI:86278737
Definition:hemagglutinin [Influenza A virus (A/Cygnus olor/Astrakhan/Ast05-2-5/2005(H5N1))]
Length:568
Sequence:
GenBank link View GeneBank Entry (at NCBI)