Nucleotide Record
Accession: DQ359693 
GI: 86371189 
Strain: A/Cygnus olor/Astrakhan/Ast05-2-2/2005(H5N1) 
Definition: Influenza A virus (A/Cygnus olor/Astrakhan/Ast05-2-2/2005(H5N1)) nonstructural protein 2 (NS2) and nonstructural protein 1 (NS1) genes, complete cds. 
Country: Russia 
District: Astrakhan 
Host: Avian 
Organism: Cygnus Olor 
Segment: NS 
Type: A 
Subtype: H5N1 
Year: 2005 
Length: 850 
Full-length: Yes 
Q-Filter Category: C4 
CDS length:678
CDS range:15-692
Sequence:GTGACAAAAACATAATGGATTCCAACACTGTGTCAAGCTTTCAGGTAGACTGCTTTCTTTGGCATGTCCGCAAACGATTTGCAGACCAAG
AACTGGGTGATGCCCCATTCCTTGACCGGCTTCGCCGAGATCAGAAGTCCCTAAGAGGAAGAGGCAACACTCTTGGTCTGGACATCGAAA
CAGCTACTCGTGCGGGAAAGCAGATAGTGGAGCGAATTCTGGAGGAGGAGTCTGATGAGGCACTTAAAATGCCAGCTTCACGCTACCTAA
CTGATATGACTCTCGAGGAAATGTCAAGGGACTGGTTCATGCTCATGCCCAAGCAGAAAGTGACAGGTTCCCTTTGCATCAAAATGGACC
AGGCAATAATGGATAAAACCATCATATTGAAAGCAAACTTCAGTGTGATTTATGACCGGTTAGAGACCCTAATACTACTTAGAGCTTTCA
CAGAAGAAGGAGCAATCGTGGGAGAAATCTCACCATTACCTTCTCTTCCAGGACATACTAATGAGGATGTCAAAAATGCAATTGGCGTCC
TCATCGGAGGACTTGAATGGAATGATAACACAGTTCGAATCTCTGAAATTATACAGAGATTCGCTTGGAGAAGCATTGATGAGGGTGGGA
GACTTCCACTCCCTCCAGATCAGAAACGGAAAATGGCGAGAACAATTGAGCCAAAAGTTTGA
AGAAATAAGGTGGCTGATTGAAGAAATA
CGACATAGATTGAAAATTACAGAAAACAGCTTCGAACAGATAACGTTTATGCAAGCCTTACAACTACTGCTTGAAGTGGAGCAAGAGATA
AGAACTTTCTCGTTTCAGCTTATTTAATGATAAAAAACAC
CDS length:366
CDS range:15-44, 502-837
Sequence:GTGACAAAAACATAATGGATTCCAACACTGTGTCAAGCTTTCAGGTAGACTGCTTTCTTTGGCATGTCCGCAAACGATTTGCAGACCAAG
AACTGGGTGATGCCCCATTCCTTGACCGGCTTCGCCGAGATCAGAAGTCCCTAAGAGGAAGAGGCAACACTCTTGGTCTGGACATCGAAA
CAGCTACTCGTGCGGGAAAGCAGATAGTGGAGCGAATTCTGGAGGAGGAGTCTGATGAGGCACTTAAAATGCCAGCTTCACGCTACCTAA
CTGATATGACTCTCGAGGAAATGTCAAGGGACTGGTTCATGCTCATGCCCAAGCAGAAAGTGACAGGTTCCCTTTGCATCAAAATGGACC
AGGCAATAATGGATAAAACCATCATATTGAAAGCAAACTTCAGTGTGATTTATGACCGGTTAGAGACCCTAATACTACTTAGAGCTTTCA
CAGAAGAAGGAGCAATCGTGGGAGAAATCTCACCATTACCTTCTCTTCCAGGACATACTAATGAGGATGTCAAAAATGCAATTGGCGTCC
TCATCGGAGGACTTGAATGGAATGATAACACAGTTCGAATCTCTGAAATTATACAGAGATTCGCTTGGAGAAGCATTGATGAGGGTGGGA
GACTTCCACTCCCTCCAGATCAGAAACGGAAAATGGCGAGAACAATTGAGCCAAAAGTTTGAAGAAATAAGGTGGCTGATTGAAGAAATA
CGACATAGATTGAAAATTACAGAAAACAGCTTCGAACAGATAACGTTTATGCAAGCCTTACAACTACTGCTTGAAGTGGAGCAAGAGATA
AGAACTTTCTCGTTTCAGCTTATTTAA
TGATAAAAAACAC
GenBank link View GenBank Entry (at NCBI)

Protein Record
Accession:ABC94733
GI:86371190
Definition:nonstructural protein 1 [Influenza A virus (A/Cygnus olor/Astrakhan/Ast05-2-2/2005(H5N1))]
Length:225
Sequence:
GenBank link View GeneBank Entry (at NCBI)
Accession:ABC94734
GI:86371191
Definition:nonstructural protein 2 [Influenza A virus (A/Cygnus olor/Astrakhan/Ast05-2-2/2005(H5N1))]
Length:121
Sequence:
GenBank link View GeneBank Entry (at NCBI)