Nucleotide Record
Accession: DQ358748 
GI: 86211370 
Strain: A/Cygnus olor/Astrakhan/Ast05-2-3/2005(H5N1) 
Definition: Influenza A virus (A/Cygnus olor/Astrakhan/Ast05-2-3/2005(H5N1)) polymerase acidic protein (PA) gene, complete cds. 
Country: Russia 
District: Astrakhan 
Host: Avian 
Organism: Cygnus Olor 
Segment: PA 
Type: A 
Subtype: H5N1 
Year: 2005 
Length: 2208 
Full-length: Yes 
Q-Filter Category: C4 
CDS length:2151
CDS range:13-2163
Sequence:TACTGATTCAAAATGGAAGATTTTGTGCGACAATGCTTCAATCCAATGATTGTCGAGCTTGCGGAAAAGGCAATGAAAGAGTATGGGGAA
GATCCGAAAATCGAAACGAACAAATTTGCTGCAATATGCACACACTTGGAGGTCTGTTTCATGTATTCGGATTTTCACTTTATTGATGAA
CGGAGTGAATCAATAATTGTAGAATCTGGAGATCCGAATGCATTATTGAAACACCGATTTGAAATAATTGAAGGAAGAGACCGAACGATG
GCCTGGACTGTGGTGAATAGTATTTGCAACACCACAGGAGTCGAGAAACCTAAATTTCTCCCAGATTTGTATGACTACAAAGAGAACCGA
TTCATTGAAATTGGAGTGACACGGAGGGAAGTTCATACATACTATCTGGAGAAGGCCAACAAGATAAAATCCGAGAAGACACATATTCAC
ATATTCTCATTCACAGGGGAGGAAATGGCAACCAAAGCGGACTACACCCTTGATGAAGAGAGCAGGGCAAGAATTAAAACCAGGCTGTTC
ACCATAAGACAGGAAATGGCCAGTAGGGGTCTATGGGATTCCTTTCGTCAATCCGAGAGAGGCGAAGAGACAATTGAAGAAAAATTTGAA
ATCACTGGAACCATGCGCAGACTTGCCGACCAAAGTCTCCCACCGAACTTCTCCAGCCTTGAAAACTTTAGAGCCTATGTGGATGGATTC
GAACCGAACGGCTGCATTGAGGGCAAGCTTTCTCAAATGTCAAAAGAAGTGAATGCTAGAATTGAGCCATTTTTGAAGACAACGCCACGC
CCTCTCAGATTACCTGATGGGCCTCCTTGCTCTCAGCGGTCGAAATTCCTGCTGATGGATGCCCTTAAATTAAGTATCGAAGACCCGAGT
CATGAGGGGGAGGGGATACCACTATACGATGCAATCAAATGCATGAAGACATTTTTCGGGTGGAAGGAGCCCAACATCGTGAAACCACAT
GAAAAGGGTATAAACCCCAATTACCTCCTGACTTGGAAGCAAGTGCTGGCAGAACTCCAAGATATTGAAAATGAGGAGAAAATCCCAAAA
ACAAAGAACATGAAAAAAACAAGCCAGTTGAGGTGGGCACTCGGTGAGAACATGGCACCAGAGAAAGTAGACTTTGAGGACTGCAAAGAT
GTTAGCGATCTAAGACAGTATGACAGTGATGAACCAGAATCTAGATCACTAGCAAGCTGGATTCAGAGTGAATTCAACAAGGCATGTGAA
TTGACAGACTCGAGTTGGATTGAACTTGATGAAATAGGAGAGGATGTTGCTCCAATTGAGCACATTGCAAGTATGAGAAGGAACTATTTT
ACAGCGGAAGTATCCCATTGCAGAGCCACTGAATACATAATGAAGGGAGTGTACATAAACACAGCCCTGTTGAATGCATCCTGTGCAGCC
ATGGATGACTTTCAACTGATTCCAATGATAAGCAAATGCAGAACCAAAGAAGGAAGACGGAAAACTAATCTGTATGGATTCATTATAAAA
GGAAGATCCCACTTGAGGAATGACACCGATGTGGTAAACTTTGTGAGTATGGAATTCTCTCTTACTGATCCGAGATTGGAGCCACACAAG
TGGGAAAAGTACTGTGTCCTCGAGATAGGAGACATGCTCCTCCGGACTGCAGTAGGTCAAGTTTCAAGGCCCATGTTCCTGTATGTGAGA
ACCAACGGAACCTCCAAGATCAAAATGAAATGGGGCATGGAAATGAGACGATGCCTTCTTCAATCCCTTCAACAAATTGAAAGCATGATT
GAAGCCGAATCCTCCGTCAAAGAGAAGGACATGACCAAAGAATTCTTTGAAAACAAATCTGAAACATGGCCGATCGGAGAATCCCCCAAA
GGAGTGGAGGAAGGCTCCATCGGAAAGGCGTGCAGAACCTTGCTGGCGAAGTCTGTGTTCAACAGTTTATATGCATCTTCACAACTCGAG
GGGTTTTCAGCTGAATCAAGAAAATTGCTTCTCATTGCTCAGGCACTTAGGGACAACCTGGAACCTGGGACCTTCGATCTTGGAGGGCTA
TATGAAGCAATTGAGGAGTGCCTGATTAACGATCCCTGGGTTTTGCTTAATGCGTCTTGGTTCAACTCCTTCCTCGCACATGCACTGAAA
TAG
TTGGGGCAATGCTACTACTTGCTATCCATACTGTCCAAAAAAGTA
GenBank link View GenBank Entry (at NCBI)

Protein Record
Accession:ABC87317
GI:86211371
Definition:polymerase acidic protein [Influenza A virus (A/Cygnus olor/Astrakhan/Ast05-2-3/2005(H5N1))]
Length:716
Sequence:
GenBank link View GeneBank Entry (at NCBI)