Nucleotide Record
Accession: DQ007623 
GI: 63004175 
Strain: A/Anas platyrhynchos/Chany Lake/9/03(H5N3) 
Definition: Influenza A virus (A/Anas platyrhynchos/Chany Lake/9/03(H5N3)) hemagglutinin (HA) gene, partial cds. 
Country: Russia 
District: Chany Lake 
Host: Avian 
Organism: Anas Platyrhynchos 
Segment: HA 
Type: A 
Subtype: H5N3 
Year: 2003 
Length: 1326 
Full-length: No 
Q-Filter Category: P1 
CDS length:1325
CDS range:<1->1326
Sequence:CAATGGGAAGCTCTGCAGCCTAAAAGGAGTGAAGCCTTTCATTTTGGGGGATTGTAGTGTAGCTGGATGGCTCCTCGGAAACCCCATGTG
TGACGAATTCCTCAATGTGCCAGAATGGTCTTACATAGTGGAGAAGGACAACCCAGTCAATGGCCTCTGGTACCCAGGGGATTTCAACGA
CTATGAAGAACTGAAACACCTATTGAGTAGCACAAACCATTTTGAGAAAATTCAAATCATCCCCAAAAGTTCTTGGTCCAATCATGATGC
TTCATCAGGGGTGAGCTCTGCATGCCCATATAATGGGAGGTCCTCCTTTTTCCGAAATGTGGTGTGGCTTATCAAAAAGAACAATGCATA
CCCAACAATAAAGAGGAGTTACAATAATACCAACCAAGAAGATCTTTTGGTGCTGTGGGGGATCCATCATCCTAATGATGCGGCAGAGCA
GACGAAGCTCTATCAAAACCCAACCACTTACGTTTCAGTTGGAACATCAACACTGAACCAGAGGTCGGTACCAGAAATAGCTACTAGACC
CAAAGTAAACGGGCAAAGTGGAAGAATGGAGTTCTTCTGGACAATTTTAAAGCCGAATGATGCCATCAATTTCGAGAGTAATGGAAATTT
TATTGCTCCAGAATATGCATACAAAATTGTCAAGAAGGGGGACTCAGCAATCATGAAAAGTGACTTGGAATACGGTAACTGCAACACCAA
ATGCCAAACTCCAATGGGTGCGATAAACTCTAGCATGCCATTCCACAACATACACCCTCTCACCATTGGGGAATGCCCTAAATACGTGAA
ATCAGATAGATTAGTCCTTGCGACTGGGCTCAGGAATGTCCCTCAAAGAGAAACAAGAGGACTATTTGGGGCTATAGCAGGCTTTATAGA
AGGAGGGTGGCAAGGCATGGTAGATGGTTGGTATGGATACCACCATAGCAACGAGCAGGGGAGTGGATACGCTGCAGACAAAGAGTCCAC
TCAAAAAGCAATAGATGGGATCACTAATAAGGTCAACTCAATCATCGACAAAATGAACACTCAGTTTGAGGCCGTTGGAAAGGAATTCAA
TAACTTGGAAAGGAGGATAGAGAATTTAAACAAGAAGATGGAAGACGGATTTCTAGATGTCTGGACTTATAATGCTGAACTTCTGGTTCT
CATGGAAAATGAGAGAACTCTAGACTTTCATGATTCAAATGTCAAGAACCTTTATGACAAAGTTCGACTACAGCTTAGGGATAATGCAAA
GGACCTGGGTAATGGTTGTTTCGAGTTCTATCCCAAATGTGATAATGATTGTATGGAAAGTGTAAC
GenBank link View GenBank Entry (at NCBI)

Protein Record
Accession:AAY25499
GI:63004176
Definition:hemagglutinin [Influenza A virus (A/Anas platyrhynchos/Chany Lake/9/03(H5N3))]
Length:442
Sequence:
GenBank link View GeneBank Entry (at NCBI)