Nucleotide Record
Accession: DQ007622 
GI: 63004173 
Strain: A/Anas platyrhynchos/Chany Lake/12/03(H3) 
Definition: Influenza A virus (A/Anas platyrhynchos/Chany Lake/12/03(H3)) hemagglutinin (HA) gene, partial cds. 
Country: Russia 
District: Chany Lake 
Host: Avian 
Organism: Anas Platyrhynchos 
Segment: HA 
Type: A 
Subtype: H3 
Year: 2003 
Length: 516 
Full-length: No 
Q-Filter Category: P1 
CDS length:515
CDS range:<1->516
Sequence:TCAAAGCTCTTCAACAGGGAAAATATGCAACAATCCTCACAGGATTCTTGATGGAAGGGACTGCACACTAATAGATGCCCTACTGGGGGA
TCCTCATTGCGATGTCTTTCAAGATGAGACATGGGATCTCTTTGTGGAGCGAAGCAATGCTTTCAGCAATTGCTACCCCTACGATGTACC
AGACTATGCATCCCTTCGATCCCTAGTTGCATCATCAGGCACATTGGAGTTCATCACAGAAGGTTTCACTTGGACAGGAGTAACTCAGAA
TGGAGGGAGCAATGCCTGCAAAAGGGGACCTACTAGCGGTTTCTTCAGTAGACTGAACTGGTTAACTAAGTCAGGAAGCGCATACCCAGT
GTTGAACGTGACTATGCCAAACAATGACAATTTTGACAAACTATACATCTGGGGAGTTCACCACCCGAGCACAAACCAAGAACAAACCAA
CTTGTATGTTCAGGCCTCAGGAAGAGTCACAGTCTCTACCAGGAGAAGCCAGCAGACTATAATCCC
GenBank link View GenBank Entry (at NCBI)

Protein Record
Accession:AAY25498
GI:63004174
Definition:hemagglutinin [Influenza A virus (A/Anas platyrhynchos/Chany Lake/12/03(H3))]
Length:172
Sequence:
GenBank link View GeneBank Entry (at NCBI)