Nucleotide Record
Accession: DQ006285 
GI: 62956623 
Strain: A/Anas platyrhynchos/Chany Lake/11/03(H3) 
Definition: Influenza A virus (A/Anas platyrhynchos/Chany Lake/11/03(H3)) hemagglutinin (HA) gene, partial cds. 
Country: Russia 
District: Chany Lake 
Host: Avian 
Organism: Anas Platyrhynchos 
Segment: HA 
Type: A 
Subtype: H3 
Year: 2003 
Length: 531 
Full-length: No 
Q-Filter Category: P1 
CDS length:531
CDS range:<1->531
Sequence:AGCTCTTCAACAGGGAAAATATGCAACAATCCTCACAGGATTCTTGATGGAAGGGACTGCACACTAATAGATGCCCTACTGGGGGATCCT
CATTGCGATGTCTTTCAAGATGAGACATGGGATCTCTTTGTGGAGCGAAGCAATGCTTTCAGCAATTGCTACCCCTACGATGTACCAGAC
TATGCATCCCTTCGATCCCTAGTTGCATCATCAGGCACATTGGAGTTCATCACAGAAGGTTTCACTTGGACAGGAGTAACTCAGAATGGA
GGGAGCAATGCCTGCAAAAGGGGACCTACTAGCGGTTTCTTCAGTAGACTGAACTGGTTAACTAAGTCAGGAAGCGCATACCCAGTGTTG
AACGTGACTATGCCAAACAATGACAATTTTGACAAACTATACATCTGGGGAGTTCACCACCCGAGCACAAACCAAGAACAAACCAACTTG
TATGTTCAGGCCTCAGGAAGAGTCACAGTCTCTACCAGGAGAAGCCAGCAGACTATAATCCCTAACATTGGATCTAGACCC
GenBank link View GenBank Entry (at NCBI)

Protein Record
Accession:AAY23642
GI:62956624
Definition:hemagglutinin [Influenza A virus (A/Anas platyrhynchos/Chany Lake/11/03(H3))]
Length:177
Sequence:
GenBank link View GeneBank Entry (at NCBI)