Nucleotide Record
Accession: DQ006284 
GI: 62956621 
Strain: A/Anas platyrhynchos/Chany Lake/10/03(H3) 
Definition: Influenza A virus (A/Anas platyrhynchos/Chany Lake/10/03(H3)) hemagglutinin (HA) gene, partial cds. 
Country: Russia 
District: Chany Lake 
Host: Avian 
Organism: Anas Platyrhynchos 
Segment: HA 
Type: A 
Subtype: H3 
Year: 2003 
Length: 528 
Full-length: No 
Q-Filter Category: P1 
CDS length:528
CDS range:<1->528
Sequence:CTAGTTCAAAGCTCTTCAACAGGGAAAATATGCAACAATCCTCACAGGATTCTTGATGGAAGGGACTGCACACTAATAGATGCCCTACTG
GGGGATCCTCATTGCGATGTCTTTCAAGATGAGACATGGGATCTCTTTGTGGAGCGAAGCAATGCTTTCAGCAATTGCTACCCCTACGAT
GTACCAGACTATGCATCCCTTCGATCCCTAGTTGCATCATCAGGCACATTGGAGTTCATCACAGAAGGTTTCACTTGGACAGGAGTAACT
CAGAATGGAGGGAGCAATGCCTGCAAAAGGGGACCTACTAGCGGTTTCTTCAGTAGACTGAACTGGTTAACTAAGTCAGGAAGCGCATAC
CCAGTGTTGAACGTGACTATGCCAAACAATGACAATTTTGACAAACTATACATCTGGGGAGTTCACCACCCGAGCACAAACCAAGAACAA
ACCAACTTGTATGTTCAGGCCTCAGGAAGAGTCACAGTCTCTACCAGGAGAAGCCAGCAGACTATAATCCCTAACATT
GenBank link View GenBank Entry (at NCBI)

Protein Record
Accession:AAY23641
GI:62956622
Definition:hemagglutinin [Influenza A virus (A/Anas platyrhynchos/Chany Lake/10/03(H3))]
Length:176
Sequence:
GenBank link View GeneBank Entry (at NCBI)