Nucleotide Record
Accession: DQ006282 
GI: 62956617 
Strain: A/Anas platyrhynchos/Chany Lake/8/03(H2) 
Definition: Influenza A virus (A/Anas platyrhynchos/Chany Lake/8/03(H2)) hemagglutinin (HA) gene, partial cds. 
Country: Russia 
District: Chany Lake 
Host: Avian 
Organism: Anas Platyrhynchos 
Segment: HA 
Type: A 
Subtype: H2 
Year: 2003 
Length: 524 
Full-length: No 
Q-Filter Category: P1 
CDS length:524
CDS range:<1->524
Sequence:CAGCATACAACAACTGGAGGTTCACGGGCCTGCGCAGTATCTGGTAACCCGTCATTTTTCAGAAACATGGTCTGGTTGACAAAGAAAGGG
TCGAATTACCCAATTGCCAAAGGATCATACAATAATACAAGTGGGGAACAAATGCTGATCATTTGGGGAGTACATCACCCCAATGATGAT
GCTGAACAAAGGACATTGTATCAGAACGTCGGGACCTATGTATCGGTGGGGACATCGACACTGAACAAAAGATCAATTCCAGAAATAGCC
ACAAGACCTAAAGTGAATGGACAGGGAGGCAGAATGGAATTCTCGTGGACTATATTGGATATGTTGGACACCATAAACTTTGAGAGTACT
GGTAATCTAATTGCACCAGAATATGGATGTAAAATATCCAAACGGGGTAGTTCAGGGATCATGAAAACGGAAGGGACACTTGAAAACTGC
GATACTAAATGCCAAACTCCCTTGGGAGCAATAAATACAACATTGCCCTTTCATAATATTCACCCCCTGAACAT
GenBank link View GenBank Entry (at NCBI)

Protein Record
Accession:AAY23639
GI:62956618
Definition:hemagglutinin [Influenza A virus (A/Anas platyrhynchos/Chany Lake/8/03(H2))]
Length:174
Sequence:
GenBank link View GeneBank Entry (at NCBI)