Nucleotide Record
Accession: AY586419 
GI: 47680888 
Strain: A/tern/Astr/775/1983(H3N3) 
Definition: Influenza A Virus (A/tern/Astr/775/83(H3N3)) neuraminidase gene, partial cds. 
Country: Russia 
District: Astr 
Host: Avian 
Organism: Tern 
Segment: NA 
Type: A 
Subtype: H3N3 
Year: 1983 
Length: 1407 
Full-length: Yes 
Q-Filter Category: P1 
CDS length:1407
CDS range:1->1407
Sequence:ATGAATCCAAATCAGAGGATAATAGCGATTGGATCTGTGAATACAGTGTTATCTACCATAGCATTGCTAGTGGGGATAGGCAATTTGGCA
TTCAATGCAGTTATTCATGGTAAAGTTGAGAATAACAAATGTGAAACTACACCGACCACTACACCCCACCCGGTTTACAACTGTAGTGAC
ACTGTAATAACAAAAAACCACACTACAATAAACAACATAACAACTGTTGTTTTTCAAGACCCAGAGACACACTTCAGACTCCCGTTGCCC
TTATGTCCCTTCAAAGGATTCTTCCCTTTCCACAAAGACAATGCCCTGAGACTAGCTGAGAACAAAGACGTTCTAGTGACTAGAGAACCC
TATATCAGTTGTGACAATGTAGGATGCTGGTCTTTTGCATTGGCTCAAGGGGCGCTTCTGGGGACAAAGCACAGCAATGGAACAAATAAG
GATAGGACACCATATAGATCCCTAATCAAATTCCCAATTGGAACAGCTCCTGTACTTGGGAACTACAAAGAGATGTGTGCTGCATGGTCG
AGCAGCAGTTGCTTCGATGGGAAGGAGTGGCTGCATGTTTGTGTTACGGGAAACGACAATGACGCAACAGCACAGATAATATATGCAGGG
AAAATGCGAGACTCTATAAAATCATGGCGGAAAAACATATTAAGAACCCAAGAATCAGAATGCCAATGTTTGTATGGAACTTGTGTTGTA
GCTGTGACAGATGGACCAGCAGACAATAAGGCAGACCACAGAGTATACTGGATAAGAGAAGGGAGAATCATAAAACACGAGAAGGTTCCA
GATGACAAGATACAACATTTGGAAGAGTGTTCATGTTACACAGATGTTGACATCTACTGTATTTGCAGAGACAACTGGAAAGGCTCTAAC
AGGCCATGGATGCGCATAAACAACGAAACTATACTGGAAACTGGATATATATGCAGCAAATTCCATTCGGACACACCCAGGCCAAGTGAT
CCCTCTACAGTGTCTTGTAGTTCTCCAAGTGGAATTGATGGTAGAAGGGGAGTCAAAGGGTTCGGATTTAAGGTCCAGAATGATGTGTGG
CTCGGAAGAACAATATCATATAGCAGCCGGTCAGGGTTCGAAGTGATCAAAGTTTCAAATGGCTGGATTGATTCGAGAAACCAGGAAAAG
GCAGCCATCCAAACACTTGTTTCCAATAATGACTGGTCCGGGTATTCAGGCAGCTTTGTCATTGAAAACAATGGCTGTTTTCAGCCCTGC
TTTTATGTTGAACTAACACGGGGAGTGCCAAACAAAAATGAGGATGTCTCTTGGACCAGCAACAGCATAGTTACTTTCTGTGGACTAGAC
AATGAACCTGGATCGGGTAATTGGCCTGATGGTGCTAACATTGGGTTTATGCCCAAG
GenBank link View GenBank Entry (at NCBI)

Protein Record
Accession:AAT37414
GI:47680889
Definition:neuraminidase [Influenza A Virus (A/tern/Astr/775/83(H3N3))]
Length:469
Sequence:
GenBank link View GeneBank Entry (at NCBI)