Nucleotide Record
Accession: AJ457883 
GI: 22859282 
Strain: A/Kalingrad/5/2000(H1N1) 
Definition: Influenza A virus (A/Kalingrad/5/2000(H1N1)) partial HA gene for haemagglutinin, genomic RNA 
Country: Russia 
District: Kalingrad 
Host: Human 
Organism: Human 
Segment: HA 
Type: A 
Subtype: H1N1 
Year: 2000 
Length: 975 
Full-length: No 
Q-Filter Category: P1 
CDS length:975
CDS range:<1->975
Sequence:GACACAATATGTATAGGCTACCATGCCAACAACTCAACCGACACTGTTGACACAGTACTTGAGAAGAATGTGACAGTGACACACTCTGTC
AACCTACTTGAGGACAGTCACAATGGAAAACTATGTCTACTAAAAGGAATAGCCCCACTACAATTGGGTAATTGCAGCGTTGCCGGATGG
ATCTTAGGAAACCCAGAATGCGAATTACTGATTTCCAAGGAATCATGGTCCTACATTGTAGAAACACCAAATCCTGAGAATGGAACATGT
TACCCAGGGTATTTCGCCGACTATGAGGAACTGAGGGAGCAATTGAGTTCAGTATCTTCATTTGAGAGATTCGAAATATTCCCCAAAGAA
AGCTCATGGCCCAAACACACCGTAACCGGAGTATCAGCATCATGCTCCCATAATGGGAAAAGCAGTTTTTACAGAAATTTGCTATGGCTG
ACGGGGAAGAATGGTTTGTACCCAAACCTGAGCAAGTCCTATGTAAACAACAAAGAGAAAGAAGTCCTTGTACTATGGGGTGTTCATCAC
CCGCCTAACATAGGGGACCAAAGGGCCCTCTATCATACAGAAAATGCTTATGTCTCTGTAGTGTCTTCACATTATAGCAGAAGATTCACC
CCAGAAATAGCCAAAAGACCCAAAGTAAGAGATCAGGAAGGAAGAATCAACTACTACTGGACTCTGCTGGAACCTGGGGATACAATAATA
TTTGAGGCAAATGGAAATCTAATAGCGCCATGGTATGCTTTTGCACTGAGTAGAGGCTTTGGATCAGGAATCATCACCTCAAATGCACCA
ATGGATGAATGTGATGCGAAGTGTCAAACACCTCAGGGAGCTATAAACAGCAGTCTTCCTTTCCAGAATGTACACCCAGTCACAATAGGA
GAGTGTCCAAAGTATGTCAGGAGTGCAAAATTAAGGATGGTTACAGGACTAAGGAACATCCCATCCATTCAATCC
GenBank link View GenBank Entry (at NCBI)

Protein Record
Accession:CAD29920
GI:22859283
Definition:haemagglutinin [Influenza A virus (A/Kalingrad/5/2000(H1N1))]
Length:325
Sequence:
GenBank link View GeneBank Entry (at NCBI)